A Change of Venue

A big announcement this morning: Myrmecos has joined ScienceBlogs. Update your bookmarks!  The new URL is: http://scienceblogs.com/myrmecos/ The move has been in the making for nearly a year. I guest blogged at SB’s “Photo Synthesis” last April and was invited to stay on, but I resisted for a variety of reasons. Perhaps the biggest is [...]

Read Full Post »

Monday Night Mystery

What in the world is this strange creature? The point breakdown* will be as follows: 2 points for order 2 points for family 2 points for genus 2 points for species 2 points for describing the behavior As in past weeks, you have to be first in each category. *What are Myrmecos points good for?  [...]

Read Full Post »

A queen in monochrome

A few days ago I posted a photo of a Prenolepis ant queen. It’s a decent photo, in focus and properly exposed. But probably not anything I’d print out and hang on the wall. Check out the monochrome version above, though (click on it to enlarge). I don’t often put my images through such severe [...]

Read Full Post »

Sunday Night Movie: Psychic Spoon-Bending

Classic Fry & Laurie:

Read Full Post »

Friday Beetle Blogging: Penthe pimelia

Penthe pimelia (Tetratomidae) Illinois, USA A couple years back I was working on the Beetle Tree of Life project as a molecular phylogeneticist. My main responsibility was to gather DNA sequence data for several hundred beetles distributed across the spectrum of Coleopteran diversity. As I’m not a Coleopterist, I spent most of my time lost [...]

Read Full Post »

Little Fire Ants

Wasmannia auropunctata – little fire ants Buenos Aires, Argentina One of the world’s worst invaders, the little fire ants have spread from the new world tropics to warmer regions around the globe, becoming especially problematic on oceanic islands. The ants above, though, are from an innocuous native population in northern Argentina. They arrived at a [...]

Read Full Post »

Anatomy of an Error

If you’ve been following the Taxonomy Fail and subsequent Myrmecology Win, you’ll know that the real Fail was my own. That blurry mash of legs and cuticle is indeed an ant, and I missed it. That I failed to discern an ant in the original image doesn’t bother me. After all, the photo was the [...]

Read Full Post »

Answer to the Monday Night Mystery

Who was the source of Monday’s DNA? As many of you discerned from the online Genbank database, the sequence came from Plega dactylota, a Neuropteran insect in the family Mantispidae. 10 points to Aaron Hardin, who guessed it first. For future reference, these genetic puzzles are only slightly more complicated than a Google search. Go [...]

Read Full Post »

The Amber Ant of Mysteries (Taxonomy Fail, updated)

Well. Raising a holy hullabaloo on the internet pays dividends. Vincent Perrichot, one of the authors on the contested PNAS paper, has sent along another aspect of the mystery fossil: Having trouble?  I’ve arranged a Formica specimen to model the pose: In the comments below, Vincent provides his perspective:

Read Full Post »

Monday Night Mystery

In a change of pace, tonight’s mystery is for the bioinformaticians. Here’s some DNA sequence: ACGAAATCGGCGAGAAAGTCGCGCCCAGCGCCGCT GTTTACTCGATTCAGGAAGCCCTGGACGCCGCAGA What sort of organism did it come from? Ten points to the first person who can pick the genus.

Read Full Post »