• Home
  • About Alex Wild
  • Articles
  • Galleries
  • Myrmecology News

Myrmecos Blog

the little things matter

Feeds:
Posts
Comments
« Taxonomy Fail
The Amber Ant of Mysteries (Taxonomy Fail, updated) »

Monday Night Mystery

April 5, 2010 by myrmecos

from wikimedia commonsIn a change of pace, tonight’s mystery is for the bioinformaticians. Here’s some DNA sequence:

ACGAAATCGGCGAGAAAGTCGCGCCCAGCGCCGCT
GTTTACTCGATTCAGGAAGCCCTGGACGCCGCAGA

What sort of organism did it come from?

Ten points to the first person who can pick the genus.

Share this:

  • Twitter
  • Facebook

Like this:

Like Loading...

Related

Posted in fun, Science | Tagged genetics | 20 Comments

20 Responses

  1. on April 5, 2010 at 5:52 pm Aaron Hardin

    Oh, I can do this one. BLAST against nr says Plega!


  2. on April 5, 2010 at 5:53 pm JasonC.

    random guess: Acyrthosiphon???


  3. on April 5, 2010 at 5:56 pm Jomez

    I second Aaron, Plega dactylota – a mantispid.


  4. on April 5, 2010 at 5:56 pm Joshua King

    Jerusalem artichoke? (Helianthus tuberosus)
    Yellow Perch? (Perca flavescens)
    Florida lancelet? (Branchiostoma floridae)

    I’m going to go with the ‘choke.


    • on April 5, 2010 at 5:57 pm Joshua King

      Oh yeah, this is an insect blog. So, one might suspect the mantispid – a totally rad beast!


  5. on April 5, 2010 at 5:59 pm Mikey Bustos, AntsCanada

    Camponotus! 😀


  6. on April 5, 2010 at 6:01 pm JasonC.

    Drosophila??? Phlebotomus????? Rhodnius?????? Anopheles? Apis? oh, I don’t know.


  7. on April 5, 2010 at 6:04 pm JasonC.

    one more wild guess: Solenopsis? Linepithema?


    • on April 5, 2010 at 6:06 pm myrmecos

      You know, if you just cut and paste every animal genus name you’re bound to hit it at some point. 🙂


  8. on April 5, 2010 at 6:08 pm Ben GH

    Genbank has a 100% match to the CAD gene of a Mantidfly called Plega dactylota


  9. on April 5, 2010 at 6:13 pm JasonC.

    How do you use Genbank? I don’t really understand it.


  10. on April 5, 2010 at 6:27 pm Julie Stahlhut

    I was way too late to be first here. Do I get a point for being first to nail it on Facebook? 🙂


  11. on April 5, 2010 at 6:31 pm JasonC.

    Ah, now I’ve finally found it.


  12. on April 5, 2010 at 6:41 pm Luke M

    Finally one I could get and I’m too late. Genbank says Plega dactylota.


  13. on April 5, 2010 at 10:52 pm Ted C. MacRae

    I would’ve so totally gotten this one if I’d gotten here earlier 🙂


  14. on April 6, 2010 at 8:06 am Yannick Wurm

    that’s funny 🙂


  15. on April 6, 2010 at 10:41 am RClark

    Plega (Mantispidae)

    Aw, I’m not first by a long shot.


  16. on April 6, 2010 at 6:37 pm Answer to the Monday Night Mystery « Myrmecos Blog

    […] was the source of Monday’s DNA? As many of you discerned from the online Genbank database, the sequence came from Plega dactylota, […]


  17. on April 16, 2010 at 2:03 pm Paul

    I Blasted it on GeneBank. Came out it belongs to me….go figure….


  18. on May 23, 2010 at 11:02 pm Rohan Joshi

    BLAST recons it as Plega!!!



Comments are closed.


  • This blog is an archive; the Myrmecos blog has moved.

    Please update your bookmarks!
  • Alex’s Galleries

    alexanderwild.com

  • Recent Photos

    # SaloméArtificial Street Photography 1Kettering, Ohio, 2022IN WINTER'S GRIPVegetazione metallica.Un regard hypnotisant / A mesmerizing gaze
    More Photos
  • Biology Links

    • Tree of Life
    • Understanding Evolution
  • Blogroll

    • Ainsley Vs Livejournal
    • Ammonite
    • Anna’s Bee World
    • Archetype
    • Arthropoda blog
    • Backyard Arthropod Project
    • Beetles in the Bush
    • biodiversity in focus
    • Bug Dreams
    • Bug Eric
    • Bug Girl’s Blog
    • Burrard-Lucas Photoblog
    • Catalogue of Organisms
    • Creature Cast
    • Dan Heller
    • Debbie's Insect Blog
    • Dechronization
    • Drawing the MotMot
    • Entomoblog
    • Evolving Thoughts
    • Fall to Climb
    • Generant
    • Historias de Hormigas
    • Life on Six Legs
    • Macromite
    • microecos
    • mirmekolozi
    • myrmecoid
    • Myrmician
    • Natural Imagery
    • Nature in the Ozarks
    • NCSU Insect Blog
    • No Cropping Zone
    • omit needless words
    • Photo Synthesis
    • Princess Peppercloud
    • Science Blogs
    • Snail’s Tales
    • Stu Jenks
    • The Ant Hunter
    • The Ant Room
    • The Bug Whisperer
    • The Loom
    • This Week in Evolution
    • What's Bugging You?
    • Wild about Ants
    • Xenogere
  • Insect Links

    • Ant Farm Forum
    • Ant Insights
    • Antweb
    • Bug Squad
    • bugguide.net
    • Xerces Society
  • Photography Links

    • Canon Photography Forums
    • Digital Photography Review
    • DIY Photography
    • Igor Siwanowicz
    • Mark Plonsky
    • photo.net
    • Piotr Naskrecki
    • The Strobist
  • Popular Posts

    • Rover Ants (Brachymyrmex patagonicus), an emerging pest species
    • Specimen Request: Army/leafcutter/bullet ant queens for morphometrics
    • Friday Beetle Blogging: Nicrophorus orbicollis
    • Myrmecology enters the age of genomics
    • New Species: Coprophanaeus caroliae
    • Eureka! Heureka! An Astonishing New Ant!
    • Ants of the Paraná, then and now
    • Reader question: who discovered the sex of ant workers?
    • Army Ants of the North
    • My, what big eyes you have...
  • Recent Posts

    • This blog has moved.
    • Friday Beetle Blogging: The Hollyhock Weevil
    • The Friday Beetle will be late…
    • Bed bugs reach an all-time high
    • Answer to the Monday Night Mystery
  • Recent Comments

    • Donald Byron Johnson on Reader question: who discovered the sex of ant workers?
    • Anonymous on Update on the Rogue Taxonomist
    • Ant on Arizona Daily Star covers “Planet of the Ants”
    • Ga. Girl on Beware the Cow-Killer
    • Anonymous on Beware the Cow-Killer
  • Categories

  • Archives

  • animation Ants aphids arachnids Argentina arizona army ants art Bees beetles behavior biodiversity biology Biology Links bugs Canon carabidae coleoptera copyright Darwin desert diptera E. O. Wilson ecology entomology Evolution fail fire ants Flies formicidae genetics google haiku Harpegnathos imaging Insect Links Insects invasive species lighting Linepithema macro macrophotography macro photography Martialis media miniscule muppets music myrmecology mystery natural history Nature new species odontomachus Parasites Paratrechina pests pheidole Photography Photography business photoshop phylogenetics phylogeny Pogonomyrmex politics predation Scarabaeidae Science SEM social insects spiders Taxonomy termites travel wasps
  • Nature Blog Network
    Add to Technorati Favorites

    Follow this blog

Blog at WordPress.com.

WPThemes.


  • Follow Following
    • Myrmecos Blog
    • Join 91 other followers
    • Already have a WordPress.com account? Log in now.
    • Myrmecos Blog
    • Customize
    • Follow Following
    • Sign up
    • Log in
    • Copy shortlink
    • Report this content
    • View post in Reader
    • Manage subscriptions
    • Collapse this bar
 

Loading Comments...
 

    %d bloggers like this: