Monday Night Mystery | Myrmecos Blog

Feeds:: Posts; Comments

« Taxonomy Fail

The Amber Ant of Mysteries (Taxonomy Fail, updated) »

Monday Night Mystery

April 5, 2010 by myrmecos

In a change of pace, tonight’s mystery is for the bioinformaticians. Here’s some DNA sequence:

ACGAAATCGGCGAGAAAGTCGCGCCCAGCGCCGCT
GTTTACTCGATTCAGGAAGCCCTGGACGCCGCAGA

What sort of organism did it come from?

Ten points to the first person who can pick the genus.

Posted in fun, Science | Tagged genetics | 20 Comments

20 Responses

on April 5, 2010 at 5:52 pm Aaron Hardin

Oh, I can do this one. BLAST against nr says Plega!
on April 5, 2010 at 5:53 pm JasonC.

random guess: Acyrthosiphon???
on April 5, 2010 at 5:56 pm Jomez

I second Aaron, Plega dactylota – a mantispid.
on April 5, 2010 at 5:56 pm Joshua King

Jerusalem artichoke? (Helianthus tuberosus)
Yellow Perch? (Perca flavescens)
Florida lancelet? (Branchiostoma floridae)

I’m going to go with the ‘choke.
- on April 5, 2010 at 5:57 pm Joshua King
  
  Oh yeah, this is an insect blog. So, one might suspect the mantispid – a totally rad beast!
on April 5, 2010 at 5:59 pm Mikey Bustos, AntsCanada

Camponotus! 😀
on April 5, 2010 at 6:01 pm JasonC.

Drosophila??? Phlebotomus????? Rhodnius?????? Anopheles? Apis? oh, I don’t know.
on April 5, 2010 at 6:04 pm JasonC.

one more wild guess: Solenopsis? Linepithema?
- on April 5, 2010 at 6:06 pm myrmecos
  
  You know, if you just cut and paste every animal genus name you’re bound to hit it at some point. 🙂
on April 5, 2010 at 6:08 pm Ben GH

Genbank has a 100% match to the CAD gene of a Mantidfly called Plega dactylota
on April 5, 2010 at 6:13 pm JasonC.

How do you use Genbank? I don’t really understand it.
on April 5, 2010 at 6:27 pm Julie Stahlhut

I was way too late to be first here. Do I get a point for being first to nail it on Facebook? 🙂
on April 5, 2010 at 6:31 pm JasonC.

Ah, now I’ve finally found it.
on April 5, 2010 at 6:41 pm Luke M

Finally one I could get and I’m too late. Genbank says Plega dactylota.
on April 5, 2010 at 10:52 pm Ted C. MacRae

I would’ve so totally gotten this one if I’d gotten here earlier 🙂
on April 6, 2010 at 8:06 am Yannick Wurm

that’s funny 🙂
on April 6, 2010 at 10:41 am RClark

Plega (Mantispidae)

Aw, I’m not first by a long shot.
on April 6, 2010 at 6:37 pm Answer to the Monday Night Mystery « Myrmecos Blog

[…] was the source of Monday’s DNA? As many of you discerned from the online Genbank database, the sequence came from Plega dactylota, […]
on April 16, 2010 at 2:03 pm Paul

I Blasted it on GeneBank. Came out it belongs to me….go figure….
on May 23, 2010 at 11:02 pm Rohan Joshi

BLAST recons it as Plega!!!

Comments are closed.

%d bloggers like this: