fun | Myrmecos Blog

Archive for the ‘fun’ Category

Sunday Night Movie: Song of the Jumping Spider

Posted in fun, Nature on July 18, 2010| 9 Comments »

From the PBS series Nature:

(as an aside, the narrator sounds suspiciously like the same guy who voiced this arachnid documentary classic)

Read Full Post »

Monday Night Mystery

Posted in fun, Mysteries on July 12, 2010| 7 Comments »

We’ve pointed and laughed at iStockphoto enough already. Let’s pick on Getty instead:

This ant is misidentified. The horror!

To collect all ten points for tonight’s mystery, be the first to provide the correct genus-level identification. Breaking with tradition, you’ll also need to explain which character(s) support your answer. No exply, no pointsy.

The cumulative points winner for the month of July will win their choice of 1) an 8×10-sized print from my photo galleries, or 2) a guest post here on Myrmecos.

Read Full Post »

Monday Night Mystery

Posted in fun, Nature, tagged mystery on April 12, 2010| 15 Comments »

What in the world is this strange creature?

The point breakdown* will be as follows:

2 points for order
2 points for family
2 points for genus
2 points for species
2 points for describing the behavior

As in past weeks, you have to be first in each category.

*What are Myrmecos points good for? The cumulative winner at the end of the month gets to choose either 1)any 8×10 print from alexanderwild.com, or 2) a guest blog post on a topic of their choosing.

[update]: the answer is here.

Read Full Post »

Sunday Night Movie: Psychic Spoon-Bending

Posted in fun on April 11, 2010| 1 Comment »

Classic Fry & Laurie:

Read Full Post »

Monday Night Mystery

Posted in fun, Science, tagged genetics on April 5, 2010| 20 Comments »

In a change of pace, tonight’s mystery is for the bioinformaticians. Here’s some DNA sequence:

ACGAAATCGGCGAGAAAGTCGCGCCCAGCGCCGCT
GTTTACTCGATTCAGGAAGCCCTGGACGCCGCAGA

What sort of organism did it come from?

Ten points to the first person who can pick the genus.

Read Full Post »

Above the Ant Line

Posted in Ants, fun, Science, tagged Ants, myrmecology, new guinea, research on April 5, 2010| 10 Comments »

[a guest post by myrmecologist Andrea Lucky]

Andrea & her intrepid field team in New Guinea

It was a dark and stormy night…

…actually, it was a dark and stormy morning. The dawn of the 7^th day of ceaseless frigid rain to be precise, and I was reminiscing about the grand old days one week before when the sun emerged and for a glorious 10 minutes it was warm enough to splash some water on my arms, legs and neck and wipe away the accumulated grime that is synonymous with field work. I wondered if that lovely burst of sunshine would ever come again (no, it wouldn’t), and every time I shiveringly remembered my quick bath I cursed myself for wasting those precious moments of sun. Washing – what was I thinking? I should have been out there looking for ants!

Papua New Guinea is a tropical paradise for any biologist, but especially for an ant biologist. (more…)

Read Full Post »

Sunday Night Movie: Cats vs. Dogs

Posted in fun, tagged aardman, animation on April 4, 2010|

From the brilliant Creature Comforts:

Read Full Post »

Saturday Links

Posted in Blogging, fun on April 3, 2010| 4 Comments »

We’re hosting a party for the roller derby girls, so I’m otherwise preoccupied today. Help yourself to some links, though:

Mark Moffett, the quintessential National Geographic bug photographer, has a new ant book.
Margaret Atwood (yes, that Margaret Atwood), reviews E. O. Wilson’s novel.
Carl Zimmer suffers genome fatigue.
Mantis shrimp glow in the dark.
Who wants to help Tim Eisele identify his mystery ants?