Bed bugs reach an all-time high

According to Google Trends, that is:

Insofar as internet search interest in particular insects reflects infestation levels, it seems summer 2010 is a banner year for our little cimicid friends. Peaks occur every summer as rising temperatures increase both the reproductive rate of the bugs and their motility.

Cimex lectularius, the common bed bug

Incidentally, it’s a shame Gawker can’t seem to figure out what real bed bugs look like. I certainly wouldn’t mind an infestation of stag beetles. That’d actually be kinda cool.

Read Full Post »

I study the wrong thing…

…according to Google Trends:

Read Full Post »

Specimen Request: Pacific Ants

This just in….

Andrea Lucky and Milan Janda are seeking specimens of the following ant taxa in 95% EtOH for a study of biogeographic patterns in Melanesian/Pacific ants:

Nylanderia (Paratrechina) vaga (Forel)
Odontomachus simillimus Smith F.
Oecophylla smaragdina Emery
Solenopsis papuana Emery
Tapinoma melanocephalum (Fabricius)
Tetramorium pacificum Mayr (Also of interest are Tetramorium insolens (F. Smith) and Tetramorium tonganum Mayr)

If you are willing to donate any of these species to this project, please contact Andrea Lucky (alucky@ncsu.edu) or Milan Janda (mjanda@oeb.harvard.edu) for details about identifications and shipping.

Thank you!

Oecophylla smaragdina

Read Full Post »

Another edition of Why I’d Rather Not Be a Bug

A recent PLoS One paper by Dejean et al documents a novel predatory behavior of Azteca andreae. Rather than waste words explaining it, here’s a video:

The key innovation is that the plant is woolly.  That is, the underside of the leaves are covered in fibrous hairs not unlike the fuzzy side of Velcro®. When paired with tarsal hooks on the tips of ants’ feet, the whole assembly behaves as such, and the ants can snare heavy prey without becoming dislodged from the leaf.

By growing structures for the ants’ footholds, the plant helps the ants catch insects that might otherwise consume it. It’s an ingenious form of self-defense.

---

source: Dejean A, Leroy C, Corbara B, Roux O, Céréghino R, et al (2010) Arboreal Ants Use the “Velcro® Principle” to Capture Very Large Prey. PLoS ONE 5(6): e11331. doi:10.1371/journal.pone.0011331

Read Full Post »

Friday Beetle Blogging: Penthe pimelia

Penthe pimelia (Tetratomidae)
Illinois, USA

A couple years back I was working on the Beetle Tree of Life project as a molecular phylogeneticist. My main responsibility was to gather DNA sequence data for several hundred beetles distributed across the spectrum of Coleopteran diversity.

As I’m not a Coleopterist, I spent most of my time lost in a befuddled daze of incomprehensible taxonomy. There are so many beetles. The larger families each hold more species than all of the vertebrates combined. Think about all the mammals and birds you know- the warblers, the polar bears, the shrews, the hummingbirds- and they don’t even add up to a quarter of the weevils. That’s just the weevils, too. Never mind the ground beetles, the rove beetles, and the leaf beetles.

I did what I could to learn about these insects. I started the Friday Beetle Blog during this time, for example, and I’d try to look up information about the species I was sequencing. At least so I might know what they looked like.

Nonetheless, Polyphaga defeated me. I just couldn’t stay ahead of the endless flow of incoming samples, and the list of species in our sequence database just got longer and longer.  I’d recognize the names of most of the things just from typing them out all the time, but couldn’t keep else much in my head about them.

One of the hundreds of beetles I sequenced was the polypore fungus beetle Penthe pimelia. I always liked that name, it would pleasingly emerge within the Tenebrionoidea in our phylogenies. Other than that, I couldn’t tell you a thing about it, not with dozens of other tenebrionoids to worry about, and hundreds of other polyphagans and so on.

So I’m pleased to report that, all on my own, here in Illinois, I’ve found Penthe pimelia. This is what they look like- velvety black, not quite as long as a penny, and painfully shy. This one was hiding out in a rotting log, presumably feasting on fungus.

Photo details (top): Canon 100mm f2.8 macro lens on a Canon EOS 50D
ISO 400, f/13, 1/200 sec, indirect flash in white box
(bottom) Canon mp-e 65mm 1-5x macro lens on a Canon EOS 50D
ISO 100, f13, 1/250 sec, diffused flash

Read Full Post »

Answer to the Monday Night Mystery

Plega sp. (Mantispidae)

Who was the source of Monday’s DNA? As many of you discerned from the online Genbank database, the sequence came from Plega dactylota, a Neuropteran insect in the family Mantispidae.

10 points to Aaron Hardin, who guessed it first.

For future reference, these genetic puzzles are only slightly more complicated than a Google search. Go to NCBI’s BLAST page, select “nucleotide blast” (because we have nucleotide data), click the box for “others” to get you out of the human genome, enter the sequence in the search box, and click the “BLAST” button.  Any significant matches should be returned from the database within a few seconds.

Read Full Post »

The Amber Ant of Mysteries (Taxonomy Fail, updated)

Well. Raising a holy hullabaloo on the internet pays dividends. Vincent Perrichot, one of the authors on the contested PNAS paper, has sent along another aspect of the mystery fossil:

Having trouble?  I’ve arranged a Formica specimen to model the pose:

In the comments below, Vincent provides his perspective:

Read Full Post »

Monday Night Mystery

In a change of pace, tonight’s mystery is for the bioinformaticians. Here’s some DNA sequence:

ACGAAATCGGCGAGAAAGTCGCGCCCAGCGCCGCT
GTTTACTCGATTCAGGAAGCCCTGGACGCCGCAGA

What sort of organism did it come from?

Ten points to the first person who can pick the genus.

Read Full Post »

Taxonomy Fail

Today’s breaking news in Ant Science is this:

Newly discovered pieces of amber have given scientists a peek into the Africa of 95 million years ago, when flowering plants blossomed across Earth and the animal world scrambled to adapt.

Suspended in the stream of time were ancestors of modern spiders, wasps and ferns, but the prize is a wingless ant that challenges current notions about the origins of that globe-spanning insect family…Inside the Ethiopian amber is an ant that looks nothing like ants found in Cretaceous amber from France and Burma.

Wow- that’s big news! I wonder what this amazing Ur-ant looks like? Fortunately, WIRED has a photo:

WIRED's caption- "Photos From Alexander Schmidt/PNAS: 1) Wingless ant"

Maybe I’m going out on a limb here, but I’ll venture that this ant looks nothing like the other ants because it is, in fact, a beetle. With clearly visible elytra, and everything.

And because the press coverage is coming out ahead of the release of the PNAS paper, we can’t check the study to see if this is WIRED’s error or if the researchers themselves actually mistook a beetle for an ant.

update: The PNAS paper (Schmidt et al., 2010, Cretaceous African life captured in amber, PNAS doi 10.1073/pnas.1000948107) is now out.  And yes, the mistake lies with the authors, as Fig. 3A shows the same beetle labeled as an ant.  They write:

The most outstanding discovery is a complete, well-preserved although enrolled, wingless female ant (Formicidae; Fig. 3A). Visible characters preclude affinities with the extinct Sphecomyrminae, which is the only subfamily recorded for contemporaneous and older ants in mid-Cretaceous Burmese and French amber (15, 16). Regardless of the subfamily, this discovery is significant because it is one of the oldest records of an ant and the earliest from Gondwana. It has been suggested that ants arose in Laurasia during the Early Cretaceous (16–18), but the present discovery challenges this hypothesis. Ants evolved concurrent with the rise of angiosperms but apparently remained scarce until radiating into the world’s most diverse and ecologically dominant eusocial organisms during the Paleogene (19). The discovery will aid in resolving the phylogeny and timescale of ant lineages.

Unless, of course, the ant is a beetle. Who the hell reviewed this paper?

update 2: on Roberto Keller’s visualization, I’m now viewing this thing as possibly not a beetle either. But still not an ant.

update 3: in the NYT, too? Ug.

Read Full Post »

Above the Ant Line

[a guest post by myrmecologist Andrea Lucky]

Andrea & her intrepid field team in New Guinea

It was a dark and stormy night…

…actually, it was a dark and stormy morning.  The dawn of the 7^th day of ceaseless frigid rain to be precise, and I was reminiscing about the grand old days one week before when the sun emerged and for a glorious 10 minutes it was warm enough to splash some water on my arms, legs and neck and wipe away the accumulated grime that is synonymous with field work. I wondered if that lovely burst of sunshine would ever come again (no, it wouldn’t), and every time I shiveringly remembered my quick bath I cursed myself for wasting those precious moments of sun. Washing – what was I thinking? I should have been out there looking for ants!

Papua New Guinea is a tropical paradise for any biologist, but especially for an ant biologist.

Read Full Post »