Posted in fun, Science, tagged genetics on April 5, 2010| 20 Comments »
In a change of pace, tonight’s mystery is for the bioinformaticians. Here’s some DNA sequence:
ACGAAATCGGCGAGAAAGTCGCGCCCAGCGCCGCT
GTTTACTCGATTCAGGAAGCCCTGGACGCCGCAGA
What sort of organism did it come from?
Ten points to the first person who can pick the genus.
Posted in fun, Science, tagged art, Bees, bombus, bumblebees, dna, double helix, entomology, genetics, Insects, Photography on March 5, 2009| 8 Comments »
This photo was ultimately rejected for a journal cover (it was the wrong shape!) but I shot it to accompany a research article that used museum specimens of midwestern bumblebees to compare current levels of genetic diversity with previous decades. Since this image won’t appear in print anytime soon, I thought I’d share it here instead.
photo details: Canon 35mm f2.0 prime lens on a Canon EOS 20D
ISO 200, 1/125 sec, f/5, indirect strobe
Posted in beetles, Insect Links, Science, tagged Biology Links, genetics, genome on March 24, 2008| 2 Comments »
The genome of the red flour beetle Tribolium castaneum was published today in Nature. This latest insect genome is interesting not for what it says about beetles but for what it says about another model species, the venerable fruit fly. The more we learn about other insect genomes- the honeybee, the mosquito, and now the flour beetle- the more we see that the famed Drosophila fruit fly is an odd little beast. The bee and now the beetle, it turns out, are both rather normal. They share a lot of proteins with mammals, and fish, and other animals we know about. Fruit flies, not so much. While we all understand that the fruit fly has a number of great qualities for lab breeding and chromosome work and blah blah blah fruit flies blah blah blah (sorry, can’t help it), its genome is so very divergent that it becomes hard to know to what we can legitimately apply our immense accumulated knowledge of fruit fly biology, other than other fruit flies. It is an unfortunate choice for a model organism.
Posted in Insect Links, Photography Links, Science, Tricks of the Trade, tagged Biology Links, entomology, Evolution, genetics on February 22, 2008| 8 Comments »
The smallest insect I’ve ever photographed made the cover of the scientific journal Genetics this week. Encarsia pergandiella, an aphelinid wasp not even a millimeter long, was the subject of a study by Perlmann, Kelly, and Hunter documenting the reproductive consequences of infection by bacterial parasite.
The wasp lab is downstairs from ours, so it wasn’t much trouble to schlep my equipment over for an afternoon session. The goal was to create a set of images to submit to the journal as potential covers, and I was more than happy to have the opportunity to shoot these charismatic little wasps. My collection is shamefully deficient in parasitoids, especially considering the importance of these insects. Encarsia wasps, for instance, are the major biocontrol agents for Whitefly.
Myrmecos Blog 